|
Elabscience Biotechnology
human stfr elisa kit Human Stfr Elisa Kit, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/Human+TFR1+(Transferrin+Receptor+1)+ELISA+Kit/pm37347744-85-13-17 Average 91 stars, based on 1 article reviews
human stfr elisa kit - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
|
R&D Systems
transferrin receptor ![]() Transferrin Receptor, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+Antibody/10__1021_slash_bc500605g-100-11-20 Average 90 stars, based on 1 article reviews
transferrin receptor - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
R&D Systems
tfr 2474 tr proteins ![]() Tfr 2474 Tr Proteins, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/Recombinant+Human+TfR+Protein%2C+CF/bio_rxiv__64898__2026__01__21__700773-163-5-10 Average 94 stars, based on 1 article reviews
tfr 2474 tr proteins - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
fc 1 20 ![]() Fc 1 20, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/CD71+Antibody%2C+anti-human/pmc08184214-16-12-6 Average 94 stars, based on 1 article reviews
fc 1 20 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
cd71 apc ![]() Cd71 Apc, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/CD71+Antibody%2C+anti-human%2C+REAfinity/pmc12320723-60-19-21 Average 93 stars, based on 1 article reviews
cd71 apc - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
R&D Systems
mouse anti tfr ![]() Mouse Anti Tfr, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+Antibody/pmc07017056-179-2-4 Average 94 stars, based on 1 article reviews
mouse anti tfr - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
R&D Systems
tfr1 pe ![]() Tfr1 Pe, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+PE-conjugated+Antibody/bio_rxiv__693424-162-140-141 Average 90 stars, based on 1 article reviews
tfr1 pe - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
OriGene
expression constructs for tfr1 ![]() Expression Constructs For Tfr1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/CD71+(TFRC)+(NM_003234)+Human+Tagged+ORF+Clone/pmc05089552-43-0-23 Average 90 stars, based on 1 article reviews
expression constructs for tfr1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
R&D Systems
polyclonal goat antibody against cd71 ![]() Polyclonal Goat Antibody Against Cd71, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+Antibody/pmc12259483-80-16-28 Average 92 stars, based on 1 article reviews
polyclonal goat antibody against cd71 - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
|
R&D Systems
human tfr ![]() Human Tfr, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/Recombinant+Human+TfR+Protein%2C+CF/pm37376196-65-0-3 Average 95 stars, based on 1 article reviews
human tfr - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
OriGene
7157 rev 5 tggatggtggtacagtcagagc 3 tfrc ![]() 7157 Rev 5 Tggatggtggtacagtcagagc 3 Tfrc, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+tfr/CD71+(TFRC)+(NM_001128148)+Human+Untagged+Clone/pmc12196323__oncotarget-16-28750-s001-52-75-74 Average 93 stars, based on 1 article reviews
7157 rev 5 tggatggtggtacagtcagagc 3 tfrc - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Bioconjugate Chemistry
Article Title: Enhancing Reactivity for Bioorthogonal Pretargeting by Unmasking Antibody-Conjugated trans-Cyclooctenes
doi: 10.1021/bc500605g
Figure Lengend Snippet: Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) Anti-TfR and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.
Article Snippet: Monoclonal mouse antibodies specific for human EpCAM (IgG2b, clone 158206) and
Techniques: Conjugation Assay, Flow Cytometry, Labeling, Control
Journal: PLoS ONE
Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase
doi: 10.1371/journal.pone.0165227
Figure Lengend Snippet: Protein sequencing results.
Article Snippet:
Techniques: Sequencing
Journal: PLoS ONE
Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase
doi: 10.1371/journal.pone.0165227
Figure Lengend Snippet: A . Huh7 cells were transiently transfected with DDK tagged TFR1 cDNA. Lysate of transfected or non-transfected cells was immunoprecipitated with DDK or AF20 mAb, followed by sequential detection of the blot with DDK and TFR1 antibodies. B . Lysate of nontransfected Huh7 cells was incubated with AF20 mAb immobilized on protein G beads, or protein G beads alone to serve as a negative control, followed by Western blot detection of beads-associated proteins by antibodies against AF20, TFR1, HSP and N + /K + ATPase, respectively. Note that a minigel was used for electrophoresis, which could not resolve proteins of similar sizes.
Article Snippet:
Techniques: Transfection, Immunoprecipitation, Incubation, Negative Control, Western Blot, Electrophoresis
Journal: PLoS ONE
Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase
doi: 10.1371/journal.pone.0165227
Figure Lengend Snippet: NIH 3T3 cells grown in 24-well plate with cover slips were transfected with expression constructs of DDK tagged TFR1, DDK tagged Na + /K + ATPase, or untagged HSP90. Cells were fixed with acid alcohol followed by staining with AF20, TFR1, DDK, and HSP90 antibodies, respectively. Note that AF20 mAb only revealed signals in TFR1 transfected cells, although all three proteins were successfully expressed in NIH 3T3 cells. In addition, cell death or unusual morphology (elongated) was observed in cells expressing the exogenous proteins (dead cells are indicated by arrows). All images were taken at 20x magnification.
Article Snippet:
Techniques: Transfection, Expressing, Construct, Staining
Journal: PLoS ONE
Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase
doi: 10.1371/journal.pone.0165227
Figure Lengend Snippet: TFR1 transfected NIH 3T3 cells were fixed and stained with either AF20 mAb (panel A) or TFR1 mAb (panel B), followed by confocal microscopy to reveal subcellular localization and 3D pattern of the protein. (C) Stacks of X axis for panels A and B, respectively.
Article Snippet:
Techniques: Transfection, Staining, Confocal Microscopy
Journal: PLoS ONE
Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase
doi: 10.1371/journal.pone.0165227
Figure Lengend Snippet: Huh7 cell lysate was subject to immunoprecipitation with AF20 mAb and retained proteins on protein G beads were treated with PNGase F at 37°C for 1hr. Samples were directly loaded onto 10% SDS-PAGE (minigel) in duplicate followed by Western blot detection using AF20 (left) and TFR1 antibodies (right), respectively. Note that an additional protein band above the 75-kd size marker was detected by TFR1 antibody from PNGase F treated sample, most likely corresponding to deglycosylated form of TFR1 (79kDd).
Article Snippet:
Techniques: Immunoprecipitation, SDS Page, Western Blot, Marker
Journal: PLoS ONE
Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase
doi: 10.1371/journal.pone.0165227
Figure Lengend Snippet: Three pairs of adjacent tissue sections of normal colon ( A ) and colon cancer ( B ) were stained with TFR1 (upper panels, 1:50 dilution) and AF20 mAb (lower panels, 1:500 dilution), respectively. Images were taken at 1000x magnification. Note that overexpression of both TFR1 and AF20 antigen was only observed in colon cancer but not in normal colon. In addition, the expression pattern and localization as revealed by TFR1 and AF20 Ab are indistinguishable.
Article Snippet:
Techniques: Staining, Over Expression, Expressing
Journal: Lung
Article Title: Soluble Transferrin Receptor-1 in Pulmonary Hypertension Associated with COPD
doi: 10.1007/s00408-025-00833-3
Figure Lengend Snippet: Tissue transferrin receptor-1 in LTX cohort. ( A ) Representative image of IHC staining for CD71 in the lung tissue of healthy donor. Scale: 50 µm. ( B ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with no/mild PH. Scale: 50 µm. ( C ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with moderate PH. Scale: 50 µm. ( D ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with severe PH. Scale: 50 µm. ( E ) Quantification of CD71-positive cells representing transferrin receptor-1 in lung tissues. ( F ) Correlation between the density of CD71-positive cells in the lung and mPAP in COPD. mPAP mean pulmonary artery pressure, V vessel
Article Snippet: Immunohistochemical (IHC) staining for transferrin receptor-1 (CD71) was conducted on formalin-fixed paraffin-embedded tissue sections using a
Techniques: Immunohistochemistry